شکل 5: نمونه ای از نتایج تست آنتی بیوگرام به روش دیسک دیفیوژن بر روی محیط مولر هینتون آگار پس از انکوباسیون

بررسی فراوانی ژنهای حدت اگزوتوکسین A، اگزوآنزیم، آلژینات و oprI وoprL  در جدایه­های سودوموناس آئروژینوزا دامی و انسانی و تعیین الگوی مقاومت آنتی­بیوتیکی

چکیده

زمینه و اهداف: سودوموناس آئروژینوزا مهمترین عامل عفونت‌های مختلف بیمارستانی و ورم پستان در گاوهای شیری و ایجاد مقاومت آنتی­بیوتیکی محسوب می­شود. هدف این مطالعه ‏تعیین مقاومت آنتی­بیوتیکی باکتری­ سودوموناس ‎آئروژینوزا و حضور ژنهای­حدت‏ در ‏نمونه­های انسانی و دامی بوده است.

مواد و روش کار: در این تحقیق ۱۰۲ سویه انسانی و دامی از سودوموناس آئروژینوزا مورد بررسی قرار گرفت. در ‏بررسی عوامل حدت باروش ‏Multiplex PCR‏ جهت تشخیص ژن‌های اختصاصی استفاده شد. همچنین آزمایش دیسک دیفیوژن و E-test بر اساس روش‏CLSI ‎‏ با آنتی­‏بیوتیکهای مختلف انجام گردید.‏‎ ‎

یافته­ها: نتایج آنتی­بیوگرام جدایه­های انسانی سودوموناس آئزوژینوزا نشان داد که بیشترین میزان مقاومت نسبت به        آنتی­بیوتیک‌های آمپی­سیلین و سفپیم (۱۰۰ %)، و بیشترین میزان مقاومت در جدایه­های دامی نسبت به آمپی­سیلین (۱۰۰%) وجود دارد. شیوع ژنoprI در ۱۰۰ درصد جدایه‌های انسانی شناسایی و تمام نمونه‌ها از نظر وجود ژن alg-D  منفی بودند. برخلاف نمونه‌های انسانی، تمامی نمونه‌های دامی از نظر وجود اگزوآنزیم S منفی بوده و فقط اگزوآنزیم Y در ۱۵جدایه (۲۵%) شناسایی شد. در جدایه‌های انسانی اگزوآنزیم T از بیشترین فراوانی برخوردار بود. به گونه ای که ۱۰۰ % نمونه‌ها از نظر این اگزوآنزیم مثبت بودند.

بحث: شیوع بالایی ژنهای حدت در بین ایزوله‌های انسانی و دامی و توجه به عملکرد این ژن­ها، در جهت شناسایی تاثیر بر بافت‌های دامی و انسانی را ضروری می­سازد. با توجه به بالا بودن میزان مقاومت‌ آنتی­بیوتیکی در سویه‌های دامی و انسانی، مصرف مناسب و به اندازه آنتی بیوتیک‌ها می­بایست رعایت گردد.

 

مقدمه

جنس سودوموناس از گروه‌های بزرگ باکتری‌ها بوده که بیش از ۸۰ گونه از آن تاکنون شناخته شده است. این باکتری شیمو ارگانوترروف بوده ولی برخی از انواع نیز شیمولیتوتروف اختیاری بوده و قادرند هیدروژن و دی اکسید کربن را به عنوان منابع انرژی به کار برند. در سال ۱۸۵۰، سدیلوت (Sedillot) ترشحات چرک سبز-آبی را در زخم‌های جراحی گزارش کردند که این زخم‌ها بسیار دیر بهبود می‌یافت. محققین ۱۰ پمپ پروتئینی را روی غشای خارجی سودوموناس آئروژینوزا شناسایی کرده‌اند که مقاومت باکتری را در برابر دترجنت‌ها و آنتی بیوتیک‌ها به آنها نسبت می‌دهند۲،۱. این باکتري داراي قدرت آنزیمی فوق العاده­اي بوده که امکان بقاي آن را در شرایط مختلف فراهم می­سازد. بیماريزایی سودوموناس آئروژینوزا به علت تولید چندین فاکتور حدت همراه سلول و فاکتورهاي خارج سلولی است. لیپوپلی ساکارید خاصیت اندوتوکسینی دارد و پیوسـیـانـیـن تولید اشکال سمی اکسیژن مانند سوپراکسید و هیدروژن پراکسید را کاتالیز می‌کند۳. سودوموناس آئروژینوزا مانند باکتری‌های گرم منفی دیگر، دارای سیستم ترشحی تیپ ‏III‏ ‏می باشد. فاکتورهای این سیستم ترشحی شامل چهار اگزوآنزیم می‌باشد که ‏ExoS‏ ،ExoT‏ ،‎ ExoUو ‏ExoY‏  است.‏ ژنهای مربوط به آنها تقریبا در اکثر ایزوله‌های بالینی و محیطی وجود داشته و در میان این چهار ‏آنزیم، ‏ExoS‏ از بقیه مهم تر و اگزوآنزیم ‏S‏ مانند اگزوتوکسین ‏A‏ دارای فعالیت ‏ADP‏ – ریبوزیل ترانسفرازی است ولی سوبسترای آن ‏به جای ‏‎۲‎‏-‏EF‏ یک پروتئین فیلامنتوس به نام ویمنتین ‏می‌باشد. مشخص شده است سویه‌های فاقد ‏ژن ‏ExoS‏ در مدل حیوانی کمتر ویرولانس بوده ExoT‏ هم دارای فعالیت ‏ADP‏ – ریبوزیل ترانسفرازی بوده و‏ExoU‏ نوعی فسفولیپاز ولی ‏ExoY‏ نقش آدنیلات سیکلازی دارد۴. سودوموناس آئروژینوزا به شدت با بیماران سرطانی و سوختگی در انسان و افرادیکه سیستم ایمنی آنها سرکوب شده است ارتباط دارد. میزان مرگ برای افراد مبتلا به این باکتری حدود ۵۰ درصد است .عفونت گوش میانی (Swimmers ear)، پوستی (به خصوص افراد دچار سوختگی)، باکتریمی، عفونت مغز استخوان و مفاصل، مننژیت و آبسه‌های مغزی، کراتیت، انتروکولیت، تب شانگهای (مشابه حصبه)، اندوکاردیت، پنومونی و عفونت مجاری ادراری می‌گردد. فقط در آبسه‌ها سودوموناس نبوده چون هوازی اجباری است۵. مقاومت ذاتی باکتری سودوموناس آئروژینوزا به آنتی­بیوتیکها به دلیل حضور پروتئین­های اختصاصی موجود در غشای خارجی این باکتری می­باشد. دو لیپوپروتئین موجود در غشای خارجی شامل ژنهای oprI و oprL است که با تاثیر بر روی سیستم انتشار دارو و ناتراوایی در غشای سلول باکتری موجب ایجاد مقاومت در سودوموناس آئروژینوزا می­گردد. شناسایی این دو ژن در این باکتری هم موجب تفکیک باکتری سودوموناس آئروژینوزا از سایر گونه­های سودوموناس شده و هم از جهت بررسی مقاومت در باکتری سودوموناس آئروژینوزا دارای اهمیت می­باشد۶. در دامها این باکتری از عوامل بیماریزای مقاوم به درمان بوده که ضررهای اقتصادی بالایی را به صنعت ‏دامپروری وارد می­کند. سودوموناس آئروژینوزا، به عنوان یکی از عوامل ایجاد کننده ورم پستان­های کلینیکی ‏با شیوع ناگهانی در گاوهای شیری مطرح است. این باکتری کمتر از ۱% و یا بیشتر از ۳% گله را درگیر ‏کرده و موجب ورم پستان­های مزمن تحت بالینی می‌شود۷. سودوموناس آئروژینوزا در آمریکا بیش از ۲ ‏بیلیون دلار، انگلستان ۹۳ میلیون یورو و در استرالیا ۱۰۰ میلیون دلار سالانه ضرر اقتصادی را به دامداران ‏تحمیل می­کند۸. بیماری ورم پستان کلینیکی ناشی از سودوموناس آئروژینوزا در اثر عواملی مانند آب آلوده، ضدعفونی نامناسب ‏کارتیه­ها و درمان  نامناسب در دوران خشکی ایجاد می­گردد و کارتیه­های گاو به عنوان مخزن انتقال باکتری ‏سودوموناس آئروژینوزا عمل می­نماید. ورم پستان حاد ناشی از سودوموناس آئروژینوزا معمولاً به ‏عفونت مزمن تبدیل شده و حتی گانگرونوز حاد در ۱۰% موارد ابتلاء به ورم پستان گزارش شده است. آنزیم­های تولید شده توسط سودوموناس آئروژینوزا در شیر در ‏دمای پاستوریزاسیون باقی مانده و موجب تخریب چربی شیر و محصولات لبنی می­گردد (۷). دی­ووس و همکاران با روش Multiplex PCR ژنهای oprI و oprL سودوموناس آئروژینوزا را در نمونه­های کلینیکی شناسایی نموده و به نقش این دو ژن در ایجاد مقاومت در این باکتری اشاره نموده­اند. در کلیه نمونه­های بالینی و محیطی مورد بررسی، این دو ژن شناسایی شده و میزان حساسیت این روش را ۱۰۰% و ویژگی ۷۴% در مقایسه با روش کشت اعلام نمودند۹. اگزوتوکسینA سودوموناس آئروژینوزا، یکی از معدود توکسین­های باکتریایی است که مکانیسم عملش در سطح مولکولی مشخص شده است. چون اگزوتوکسینA ، دارای خواص متوقف سازی سنتز پروتئین می‌باشد، می‌تواند در ساخت ایمونوتوکسین‌ها استفاده گردد. این ترکیب برای ماکروفاژهای انسانی سیتوتوکسیک بوده و از پاسخ دهی سلول‌های طحال موش هم ممانعت به عمل می‌آورد. از فعالیت سلولهای تک هسته ای انسانی جلوگیری کرده و جلوی فعالیت پروجنیتورهای گرانولوسیت-ماکروفاژ را در مغز استخوان انسان می‌گیرد۱۰. سنا حسین در سال ۲۰۱۳، ژنهای Exot A و oprI را در نمونه­های سودوموناس آئروژینوزا جداشده از نمونه­های بالینی مورد بررسی قرار داد، که در نتایج این تحقیق تمام نمونه­ها دارای ژن oprI بوده ولی ۸۰% نمونه­ها واجد ژن Exot A بودند و استفاده از روشهای ملکولی را بر ای تعیین تولید توکسین موثر اعلام نمود۱۱. Feltman‏ و همکارانexoS ‎‏ را در ۶۷ (۷۱%) از ۹۵ سویه بالینی مورد بررسی شناسایی نمودند. این نتایج در مقایسه با گزارشات قبلی که حضور

ژن ‏exoS‏ را در تمام سویه­های ‏بالینی سودوموناس آئروژینوزا منفی اعلان کرده بودند، تفاوت دارد. با این حال، برآورد شیوع واقعی این ژن یا تولید ‏ExoS به طور قابل توجهی ‏متفاوت است۱۲. آلژینات امکان بقاء و حالت تهاجمی سودوموناس آئروژینوزا را با استفاده از چندین استراتژی افزایش می‌دهد، به عنوان یک سد حفاظتی برای سلولهای باکتری در مقابل فاگوسیت‌ها و آنتی بیوتیک‌ها عمل می‌کند، دلیل این ویژگی خصوصیت اسیدی این پلیمر و توانایی به دام انداختن آنتی بیوتیکهای کاتیونی است و همچنین می‌تواند رادیکال‌های اکسیداتیو که توسط سلولهای فاگوسیت رها می‌شوند را فروبنشاند. آلژینات دارای ۱۲ ژن از جمله algA و algD می­باشد و این ژنها تحت کنترل پروموتر آلژینات D قرار دارند. ژنهای algA, algC و algD آنزیم­های لازم برای بیوسنتز پیشرو آلژینات –GDP مانورونیک اسید را رمز­دهی می­کنند. ژنهای alg44 ;algK ;algX و ;alg8در پلیمریزاسیون، ژنهایalgL algG ;algF ;algJ و ;algIدر تغییرات و ژن algE در خروج آلژینات از غشای خارجی دخالت دارند.

مواد و روش­ها

جمع‌آوری و انتقال نمونه

در این مطالعه توصیفی-مقطعی که در بازه زمانی بین تابستان ۱۳۹۳ تا آذر ماه ۱۳۹۶ به طول انجامید، تعداد ۵۱ مورد نمونه­های انسانی (خلط، خون، ادرار، ترشحات زخم) از مراکز درمانی بیمارستانی تهران که مشکوک به سودوموناس بوده و ۵۱ نمونه­های دامی از شیر خام دامداریهای مختلف استان تهران که دارای علائم ورم پستان بودند، جمع­آوری و با انتقال به آزمایشگاه، کشت ابتدایی بر روی نمونه­ها انجام شد. برای کشت از محیطهای بلادآگار و مک­کانکی آگار و ستریمیدآگار (مرک، آلمان) استفاده و بعد از انکوباسیون به مدت ۲۴ ساعت در ۳۷ درجه­ سانتیگراد، کلونی­های رشد یافته از نظر مورفولوژی و تولید

رنگدانه بررسی و پس از رنگ­آمیزی گرم، باکتریهای لاکتوز منفی برای انجام آزمونهای تاییدی خالص سازی شدند. آزمونهای اکسیداز و کشت بر روی محیط TSI (مرک، آلمان)، تست اوره­آز، سیمون سیترات جهت تایید باکتری سودوموناس آئروژینوزا انجام شد۱۳.

 

آنتی­بیوگرام

بعد از تایید نهایی باکتری­ سودوموناس آئروژینوزا جداسازی شده، نمونه­ها بر روی محیط مولرهینتون آگار (مرک، آلمان) کشت داده شد. دیسک­های آنتی­بیوتیکی تجاری از شرکتHimedia Laboratories Pvt.Limited-India) ) تهیه گردید. این دیسک­ها شامل سیپروفلوکساسین (µg 5)، آمیکاسین (µg 30)، سفتریاکسون (µg 30)، سفتازیدیم (µg 30)، آمپی سیلین (µg 10)، سفپیم (µg 30)، ایمی پنم(µg 10)، جنتامایسین (µg 10)، کانامایسین (µg 30)، مروپنم (µg 10) و تتراسایکلین (µg 30) و انروفلوکساسین (µg 10) بود که بعد از قرار دادن بر روی محیط مولر هینتون، به مدت ۲۴ ساعت در گرمخانه قرار گرفت. بعد از گرمخانه­گذاری، نتایج قرائت و قطر‌هاله عدم رشد و مقاومت باکتری به آنتی­بیوتیک براساس جدول (CLSI)Clinical and Laboratory Standards Institute ثبت گردید۱۴.

 

 

تعیین میزان کمترین غلظت ممانعت از رشد MIC به روش E.test

جهت انجام آزمایش تعیین حداقل غلظت ممانعت از رشد MIC‌ ( Minimum Inhibitory Concentration) از روش E.test (Epsilometer test) استفاده گردید. این آزمایش بر روی نمونه­های انسانی با آنتی­بیوتیکهای آمیکاسین، جنتامایسین، سیپروفلوکساسین، مروپنم، ایمی­پنم و سفپیم تهیه شده از شرکت HIMEDIA Pvt.Limited-INDIA) Himedia Laboratories) انجام شد. برای انجام این تست بر روی نمونه­های دامی با آنتی‌بیوتیک‌های آمیکاسین، جنتامایسین و سیپروفلوکساسین انجام گردید. در این مطالعه از نوارهای E.test از نوع

Strip (نواری) و Comb (شانه‌ای) استفاده شد. در روش E.test پس از تهیه سوسپانسیون باکتریایی به روش نیم مک فارلند برای نمونه­های مورد مطالعه، با سوآپ استریل بر روی پلیت مولر هینتون آگار کشت داده و سپس نوارهای را که هرکدام معرف یک نوع آنتی بیوتیک بوده بر روی آگار قرار داده و پس از ۲۴ ساعت انکوباسیون در ۳۷ درجه منطقه عدم رشد که به شکل گلابی شکل ایجاد شده بود را در حدفاصل کمترین نقطه تماس با نوار آنتی­بیوتیکی قرائت شد۱۵.

 

استخراج DNA باکتری

برای استخراج DNA باکتری از کیت تجاری MBST (Molecular Biology Transfer System) جهت استخراج DNA استفاده نموده و پس از استخراج DNA در فریزر ۲۰- درجه­سانتیگراد تا انجام آزمونهای ملکولی ذخیره گردید. همچنین پرایمرهای مورد نیاز این طرح شامل پرایمر Exot A، اگزوآنزیمS و آلژینات و پرایمر ژنهای oprI و oprL (طبق جداول ۱ و ۲) به شرکت (تکاپوزیست) سفارش داده شد۱۶. بعد از انجام روند آزمون و انتقال محصول به روی ژل و مشاهده در دستگاه داده­ها آنالیز گردید.

 

برنامه زمانی و میزان مخلوط واکنش Multiplex-PCR ژنهای حدت

برنامه آزمون ‏Multiplex-PCR‏: مرحله دناتوراسیون اولیه ۹۵ درجه سانتیگراد به مدت ۱۰ دقیقه، مرحله دناتوراسیون ‏‏۹۴ درجه سانتیگراد به مدت ۳۰ ثانیه، مرحله اتصال ۵۵ درجه سانتیگراد به مدت ۷۰ ثانیه، مرحله بسط ۷۲ درجه ‏سانتیگراد به مدت ۱ دقیقه (تعداد ۳۵ سیکل)، مرحله بسط نهایی ۷۲ درجه سانتیگراد به مدت ۱۰ دقیقه می­باشد. ‏ مخلوط­های استفاده شده جهت انجام واکنش به این شرح می‌باشد: آب مقطر ۵/۳ میکرولیتر، ‏‎Master Mix شرکت Amplicon به میزان ۵/۱۲ میکرولیتر، پرایمرهای مورد ‏استفاده هرکدام ۵/۰ میکرولیتر، نمونه ‏DNA‏ ۴ میکرولیتر در حجم ‏نهایی ۲۵ میکرولیتر تهیه گردید۱۷. ‏

جدول ۱: پرایمرهای مورد استفاده در این تحقیق برای شناسایی ژنهای حدت  ۱۷

جدول پرايمرهاي مورد استفاده
اندازه باند (bp) ژن هدف توالی پرایمر (۵’ to 3’) پرایمر
۳۹۶ ETA ‎GACAACGCCCTCAGCATCACCAGC ETA-F
۳۹۶ ETA CGCTGGCCCATTCGCTCCAGCGCT‎ ETA-R
۵۰۴ oprL ATG GAAATGCTGAAATTCGGC oprL-F
۵۰۴ oprL CTTCTTCAGCTCGACGCGACG oprL-R
۲۴۹ oprI ‎ATGAACAACGTTCTGAAATTCTCTGCT oprI-F
۲۴۹ oprI ‎CTTGCGGCTGGCTTTTTCCAG oprI-R
۵۲۰ Alg

Alg

‎TTCCCTCGCAGAGAAAACATC

‎CCTGGTTGATCAGGTCGATCT

Alg-F

Alg-R

جدول ۲: مشخصات پرایمرها جهت تکثیر ژن‌های اگزوتوکسین جدایه‌های سودوموناس آئروژینوزا ۱۸

طول قطعه bp توالی DNA پرایمر ژن تکثیر یافته
۱۱۸
F, (5́-GCG AGG TCA GCA GAG TAT CG-3΄)
R, (5́-TTC GGC GTC ACT GTG GAT GC-3΄)
exo S
۱۵۲
F, (5΄-AAT CGC CGT CCA ACT GCA TGC G-3΄)
R, (5΄-TGT TCG CCG AGG TAC TGC TC-3΄)
exo T
۱۳۴ F, (5΄-CCG TTG TGG TGC CGT TGA AG-3΄)

R, (5΄-CCA GAT GTT CAC CGA CTC GC-3΄

exo U
۲۸۹ F, (5΄-CGG ATT CTA TGG CAG GGA GG-3΄)

R, (5΄-GCC CTT GAT GCA CTC GAC CA-3΄

exo Y

 

 

برنامه زمانی و میزان مخلوط واکنش PCR جهت شناسایی تکثیر ژن­های اگزوتوکسین جدایه­های سودوموناس آئروژینوزا

برنامه آزمون ‏Multiplex-PCR‏ شامل مرحله دناتوراسیون اولیه ۹۴ درجه سانتیگراد به مدت ۳ دقیقه، مرحله دناتوراسیون ‏‏۹۴ درجه سانتیگراد به مدت ۴۰ ثانیه، مرحله اتصال ۵۸ درجه سانتیگراد به مدت ۴۰ثانیه، مرحله بسط ۶۸ درجه ‏سانتیگراد به مدت ۱ دقیقه (تعداد ۳۶ سیکل)، مرحله بسط نهایی ۶۸ درجه سانتیگراد به مدت ۷ دقیقه می­باشد. ‏ مخلوط­های استفاده شده جهت انجام واکنش به این شرح می­باشد: آب مقطر ۵/۶ میکرولیتر، ‏‎Master Mix شرکت Amplicon به میزان ۵/۱۲ میکرولیتر، پرایمرهای مورد ‏استفاده هرکدام ۵/۰ میکرولیتر، نمونه ‏DNA‏ ۲ میکرولیتر در حجم ‏نهایی ۲۵ میکرولیتر تهیه گردید۱۸. ‏

نتایج

بعد از جمع آوری تعداد ۱۰۲ نمونه‌های انسانی و نمونه‌های دامی و انتقال به آزمایشگاه، کشت بر روی محیطهای اختصاصی انجام شد و بعد از انکوباسیون به مدت ۲۴ ساعت در ۳۷ درجه سانتیگراد، کلونی‌های رشد یافته از نظر مورفولوژی و تولید رنگدانه بررسی و پس از رنگ آمیزی گرم، باکتریهای گرم منفی و لاکتوز منفی برای انجام آزمونهای تاییدی خالص سازی شدند. در نهایت تمامی جدایه‌هایی که وارد مطالعه شدند از نظر الگوی تست‌های افتراقی به صورت زیر مشاهده شدند. در نهایت ۵۱ نمونه انسانی و ۵۱ نمونه دامی شناسایی گردید. کشت برروی محیط ستریمید آگار و براث پیگمان سبز مایل به آبی رانشان داد، هرچند برخی نمونه­ها پیگمان قرمز هم از خود بروز دادند. تست سیترات تمامی جدایه‌ها مثبت و تست اندول تمامی جدایه‌ها منفی و تستVP تمامی جدایه‌ها منفی و تست متیل رد وتست اکسیداز تمامی جدایه‌ها مثبت و تست کاتالاز تمامی

جدایه‌ها مثبت و تمامی جدایه‌ها در محیط کشت ستریمید رشد و تولید پیگمان کردند. جدایه­ها بعد از رشد در محیط TSI به صورت ALK/ALK مشاهده شدند. آزمون اوره تمامی جدایه­ها شناسایی شده مثبت گزارش گردید.

 

نتایج Multiplex-PCR جدایه­های انسانی از نظر اگزوآنزیم­­های S,U,Y,T

در جدایه‌های انسانی سودوموناس آئروژینوزای بررسی شده در این مطالعه از نظر وجود ژنهای اگزوآنزیم‌های Y با طول باند bp 289، U با طول باند bp 134، T با طول باند bp 152 و S با طول باند bp 118، اگزوآنزیم T از بیشترین فراوانی

برخوردار بود. به گونه ای که ۱۰۰ % نمونه‌ها از نظر این اگزوآنزیم مثبت بودند (شکل ۱). فراوانی و درصد هر یک از اگزوآنزیم‌های بررسی شده در نمودار ۱ آمده است.

نتایج Multiplex-PCR جدایه­های دامی از نظر اگزوآنزیم­های S,U,Y,T

برخلاف نمونه‌های انسانی، فراوانی این اگزوآنزیم‌ها در نمونه‌های دامی خیلی کمتر بوده است (شکل ۲). تمامی نمونه‌ها از نظر وجود اگزوآنزیم S منفی بودند و فقط اگزوآنزیم Y در ۱۵ جدایه (۲۵%) و اگزوآنزیم U و T در (۶/۶۸%) شناسایی شد (نمودار ۲).

نمودار 1: فراوانی اگزوآنزیم‌های Y، U، T و S در 51 جدایه انسانی سودوموناس آئروژینوزا بر حسب تعداد و درصد
نمودار ۱: فراوانی اگزوآنزیم‌های Y، U، T و S در ۵۱ جدایه انسانی سودوموناس آئروژینوزا بر حسب تعداد و درصد

 

شکل 1: نتایجPCR Multiplex- جهت شناسایی ژنهای اگزوآنزیم‌های Y با طول باند bp 289، U با طول باند bp 134، T با طول باند bp 152 و S با طول باند bp 118، در نمونه¬های انسانی - شماره گوده¬ها به ترتیب از چپ به راست: چاهک اول نشانگر 50 bp، چاهک دوم کنترل مثبت، چاهک سوم کنترل منفی، چاهک 31 تا 42 نمونه¬های انسانی واجد ژنهای مختلف
شکل ۱: نتایجPCR Multiplex- جهت شناسایی ژنهای اگزوآنزیم‌های Y با طول باند bp 289، U با طول باند bp 134، T با طول باند bp 152 و S با طول باند bp 118، در نمونه¬های انسانی – شماره گوده¬ها به ترتیب از چپ به راست: چاهک اول نشانگر ۵۰ bp، چاهک دوم کنترل مثبت، چاهک سوم کنترل منفی، چاهک ۳۱ تا ۴۲ نمونه¬های انسانی واجد ژنهای مختلف
نمودار 2: فراوانی اگزوآنزیم‌های Y، U، T و S در 51 جدایه دامی سودوموناس آئروژینوزا بر حسب تعداد و درصد
نمودار ۲: فراوانی اگزوآنزیم‌های Y، U، T و S در ۵۱ جدایه دامی سودوموناس آئروژینوزا بر حسب تعداد و درصد
شکل 2: نتایجPCR Multiplex- جهت شناسایی ژنهای اگزوآنزیم‌های Y با طول باند bp 289، U با طول باند bp 134، T با طول باند bp 152 و S با طول باند bp 118، در نمونه¬های دامی - شماره گوده¬ها به ترتیب از چپ به راست: چاهک اول نشانگر 50 bp، چاهک دوم کنترل مثبت، چاهک سوم کنترل منفی، چاهک 13 تا 24 نمونه¬های دامی واجد ژنهای مختلف
شکل ۲: نتایجPCR Multiplex- جهت شناسایی ژنهای اگزوآنزیم‌های Y با طول باند bp 289، U با طول باند bp 134، T با طول باند bp 152 و S با طول باند bp 118، در نمونه¬های دامی – شماره گوده¬ها به ترتیب از چپ به راست: چاهک اول نشانگر ۵۰ bp، چاهک دوم کنترل مثبت، چاهک سوم کنترل منفی، چاهک ۱۳ تا ۲۴ نمونه¬های دامی واجد ژنهای مختلف

نتایج Multiplex-PCR جدایه‌های انسانی از نظر وجود ژنهای OPR-L، OPR-I، ALG-D، EXO-S و EXT-A

بر اساس نتایج به دست آمده، شیوع ژن OPR-I بیشتر از سایر ژن‌ها بوده و در ۱۰۰ درصد جدایه‌های انسانی سودوموناس آئروژینوزای بررسی شده وجود داشت. با این حال تمام نمونه‌ها از نظر وجود ژن ALG-D منفی بودند (شکل ۳). فراوانی سایر ژنها بر اساس نتایج بدست آمده در نمودار ۳ نشان داده شده است.

نمودار 3: فراوانی ژنهای OPR-L، OPR-I، ALG-D، EXO-S و EXT-A در 51 جدایه انسانی سودوموناس آئروژینوزا
نمودار ۳: فراوانی ژنهای OPR-L، OPR-I، ALG-D، EXO-S و EXT-A در ۵۱ جدایه انسانی سودوموناس آئروژینوزا
شکل 3: نتایجPCR Multiplex- جهت شناسایی ژنهای ژنهای OPR-L با طول باند bp 504، OPR-I با طول باند bp 249، ALG-D با طول باند bp 520، EXO-S با طول باند bp 118 و EXT-A با طول باند bp 396، در نمونه¬های انسانی، - شماره گوده¬ها به ترتیب از چپ به راست: چاهک اول نشانگر 50 bp، چاهک دوم کنترل مثبت، چاهک سوم کنترل منفی، چاهک چهارم تا دهم نمونه¬های انسانی واجد ژنهای مختلف
شکل ۳: نتایجPCR Multiplex- جهت شناسایی ژنهای ژنهای OPR-L با طول باند bp 504، OPR-I با طول باند bp 249، ALG-D با طول باند bp 520، EXO-S با طول باند bp 118 و EXT-A با طول باند bp 396، در نمونه¬های انسانی، – شماره گوده¬ها به ترتیب از چپ به راست: چاهک اول نشانگر ۵۰ bp، چاهک دوم کنترل مثبت، چاهک سوم کنترل منفی، چاهک چهارم تا دهم نمونه¬های انسانی واجد ژنهای مختلف

نتایج Multiplex-PCR جدایه‌های دامی از نظر وجود ژنهای OPR-L، OPR-I، ALG-D، EXO-S و EXTA

بر اساس نتایج به دست آمده از بررسی‌های انجام شده، شیوع ژن OPR-I بیشتر از سایر ژن‌ها بوده و در ۱۰۰ درصد جدایه‌های دامی سودوموناس آئروژینوزای بررسی شده وجود داشت (شکل ۴). با این حال تمام نمونه‌ها از نظر وجود ژن ALG-D منفی بودند. فراوانی سایر ژنها بر اساس نتایج بدست آمده در نمودار ۴ نشان داده شده است.

نمودار 4: فراوانی ژنهای OPR-L، OPR-I، ALG-D، EXO-S و EXT-A در 51 جدایه دامی سودوموناس آئروژینوزا
نمودار ۴: فراوانی ژنهای OPR-L، OPR-I، ALG-D، EXO-S و EXT-A در ۵۱ جدایه دامی سودوموناس آئروژینوزا
شکل 4: نتایجPCR Multiplex- جهت شناسایی ژنهای ژنهای OPR-L با طول باند bp 504، OPR-I با طول باند bp 249، ALG-D با طول باند bp 520، EXO-S با طول باند bp 118 و EXT-A با طول باند bp 396، در نمونه¬های دامی - شماره گوده¬ها به ترتیب از چپ به راست: چاهک اول نشانگر 50 bp، چاهک دوم کنترل مثبت، چاهک سوم کنترل منفی، چاهک چهارم تا دهم نمونه¬های دامی واجد ژنهای مختلف
شکل ۴: نتایجPCR Multiplex- جهت شناسایی ژنهای ژنهای OPR-L با طول باند bp 504، OPR-I با طول باند bp 249، ALG-D با طول باند bp 520، EXO-S با طول باند bp 118 و EXT-A با طول باند bp 396، در نمونه¬های دامی – شماره گوده¬ها به ترتیب از چپ به راست: چاهک اول نشانگر ۵۰ bp، چاهک دوم کنترل مثبت، چاهک سوم کنترل منفی، چاهک چهارم تا دهم نمونه¬های دامی واجد ژنهای مختلف

نتایج آزمون حساسیت آنتی بیوتیکی ایزوله‌های انسانی

الگوی حساسیت و مقاومت ۵۱ جدایه انسانی سودوموناس آئزوژینوزا نسبت به ۱۰ آنتی بیوتیک مختلف با روش دیسک دیفیوژن پس از گذشت مدت زمان انکوباسیون لازم، قرائت و ثبت گردید. (شکل ۵) بیشترین میزان مقاومت نسبت به آنتی­بیوتیک‌های آمپی سیلین و سفپیم (۱۰۰ % مقاوم)، و کمترین میزان آن نسبت به داروی آمیکاسین (۹/۹ %) مشاهده شد. بیشترین میزان حساسیت نیز به آنتی­بیوتیک آمیکاسین با ۳/۸۰% قرائت شد(جدول ۳).

بر اساس نتایج تست آنتی بیوگرام، مقاومت همزمان به بیش از یک دارو نیز مشاهده شد. مقاومت همزمان به ۳ آنتی بیوتیک (کانامیسین، آمپی سیلین، سفپیم) شایعترین حالت بوده که در ۱۶ جدایه مشاهد گردید. همچنین ۲ جدایه نسبت به تمام آنتی بیوتیک‌های بررسی شده مقاومت نشان دادند. این در حالی است که حساسیت نسبت به تمام آنتی بیوتیک‌های بررسی شده در هیچ یک از جدایه‌ها وجود نداشت (نمودار ۵).

شکل 5: نمونه ای از نتایج تست آنتی بیوگرام به روش دیسک دیفیوژن بر روی محیط مولر هینتون آگار پس از انکوباسیون
شکل ۵: نمونه ای از نتایج تست آنتی بیوگرام به روش دیسک دیفیوژن بر روی محیط مولر هینتون آگار پس از انکوباسیون

جدول ۳: میزان حساسیت جدایه‌های انسانی سودوموناس آئزوژینوزا نسبت به آنتی بیوتیکهای مختلف با روش دیسک دیفیوژن برحسب تعداد و درصد

نوع آنتی بیوتیک میزان مقاومت (%)

Resistance

حساسیت متوسط(%)

Intermediate

میزان حساسیت (%)

Sensitive

مروپنم ۱۵ (۵/۲۹) ۱ (۹/۱) ۳۵ (۶/۶۸)
ایمی­پنم ۷ (۹/۱۳) ۸ (۶/۱۵) ۳۶ (۵/۷۰)
سفتریاکسون ۳۱ (۶۱) ۴ (۸/۷) ۱۶ (۲/۳۱)
سیپروفلوکساسین ۱۱ (۷/۲۱) ۳ (۸/۵) ۳۷ (۵/۷۲)
سفتازیدیم ۱۴ (۶/۲۷) ۲ (۸/۳) ۳۵ (۶/۶۸)
آمپی­سیلین ۵۱ (۱۰۰)
سفپیم ۵۱ (۱۰۰)
کانامایسین ۴۸ (۳/۹۴) ۱ (۹/۱) ۲ (۸/۳)
جنتامایسین ۱۳ (۵/۲۵) ۳۸ (۵/۷۴)
آمیکاسین ۵ (۹/۹) ۵ (۸/۹) ۴۱ (۳/۸۰)

 

 

 

نتایج آزمون حساسیت آنتی بیوتیکی ایزوله‌های دامی

بررسی ۵۱ جدایه دامی سودوموناس آئزوژینوزا نسبت به ۱۰ آنتی بیوتیک مختلف نشان داد که بیشترین میزان میزان مقاومت نسبت به داروهای آمپی سیلین (۱۰۰%) وجود دارد. حساسیت کامل (۱۰۰%) نسبت به آنتی بیوتیک‌های ایمی پنم، سیپروفلوکساسین، انروفلوکساسین، جنتامایسین و آمیکاسین مشاهده شد (جدول ۴).

مقاومت همزمان در جدایه‌های دامی نیز مشاهده شد. شایعترین حالت، مقاومت همزمان نسبت به ۳ آنتی بیوتیک (کانامایسین، آمپی سیلین، تتراسایکلین) بود که ۲۵ جدایه دامی این حالت را داشتند. مقاومت نسبت به تمام آنتی بیوتیک‌های بررسی شده در هیچ یک از جدایه‌های دامی مشاهده نگردید. (نمودار ۶).

نمودار 5: فراوانی جدایه‌های انسانی سودوموناس آئزوژینوزا دارای مقاومت‌های چندگانه
نمودار ۵: فراوانی جدایه‌های انسانی سودوموناس آئزوژینوزا دارای مقاومت‌های چندگانه

جدول ۴: میزان حساسیت سویه‌های دامی سودوموناس آئزوژینوزا نسبت به آنتی بیوتیکهای مختلف با روش دیسک دیفیوژن برحسب تعداد و درصد

نوع آنتی بیوتیک میزان مقاومت (%)

Resistance

حساسیت متوسط(%)

Intermediate

میزان حساسیت (%)

Sensitive

ایمی­پنم ۵۱ (۱۰۰)
سفتریاکسون ۲۳ (۱/۴۵) ۳ (۸/۵) ۲۵ (۱/۴۹)
سیپروفلوکساسین ۵۱ (۱۰۰)
تتراسایکلین ۴۸ (۱۱/۹۴) ۲ (۹۲/۳) ۱ (۹۷/۱)
آمپی­سیلین ۵۱ (۱۰۰)
انروفلوکساسین ۵۱ (۱۰۰)
کانامایسین ۴۸ (۱۱/۹۴) ۳ (۸۹/۵)
جنتامایسین ۵۱ (۱۰۰)
آمیکاسین ۵۱ (۱۰۰)

 

نمودار 6: فراوانی جدایه‌های دامی سودوموناس آئزوژینوزا دارای مقاومت‌های چندگانه
نمودار ۶: فراوانی جدایه‌های دامی سودوموناس آئزوژینوزا دارای مقاومت‌های چندگانه

چندگانه

 

 

بحث

در تحقیق حاضر مشخص گردید که میزان آلودگی شیر گاوهای مبتلا به ورم پستان­های با ویژگی­های تحت بالینی ۳۴ درصد بوده که این میزان فراوانی با توجه به نتایج مطالعات فوق همخوانی نداشته که می­تواند ناشی از منطقه جغرافیایی مورد مطالعه، ضعف مدیریت مزارع، وجود آبهای آلوده و یا مخازن آلوده به این باکتری باشد. به طور کلی گزارش میزان آلودگی و بررسی مقاومت‌های آنتی‌بیوتیکی و عوامل بیماریزای باکتری سودوموناس آئروژینوزا در دام‌های ایران بسیار کم بوده ولی با توجه به افزایش شیوع و استفاده از آنتی بیوتیکهای مختلف در درمان بدون انجام آزمایش آنتی بیوگرام می‌تواند نقش مهمی در ایجاد سویه‌های مقاوم ایفا نماید. این باکتري از مهمترین عوامل بیماري و مرگ و میر در مبتلایان به فیبروز سیستیک، نئوپلاسمی و سوختگی‌هاي شدید در انسان است. در دهه‌هاي اخیر در پی ابداع درمان آنتی بیوتیکی، سودوموناس آئروژینوزا به دلیل مقاومت ذاتی به اکثر آنتی بیوتیک­ها به عنوان یکی از مهم‌ترین پاتوژن‌هاي بیمارستانی شناسایی شده است. در مطالعه آذرگون و همکاران از ۵۱ نمونه سودوموناس آئروژینوزا ‏جداسازی شده از بیماران مبتلا به سیستیک فیبروزیس، ۲/۳۷% مقاوم به جنتامایسین، ۵/۲۱% مقاوم به آمیکاسین، ۷/۱۵% ‏مقاوم به سپیروفلوکساسین و ۸/۹% مقاوم به سفتازیدیم بودند۱۹. در مطالعه حاضر میزان حساسیت نسبت به آمیکاسین در بین نمونه­های بالینی ‏‏۳/۸۰% بود که در مقایسه با سایر مطالعات به عمل آمده مقاومت کمتری را نشان ‏داد. از طرفی در مطالعات میرصالحیان و همکاران  (۲۰) میزان مقاومت به این آنتی بیوتیک بسیار ‏بالا بوده است. به نظر می‌رسد این تفاوت می‌تواند به دلیل تفاوت در منبع سویه‌ها باشد. میزان مقاومت ‏سودوموناس آئروژینوزا به آنتی بیوتیک سیپروفلوکساسین در مطالعات یزدی و همکاران۲۱، شاهچراغی و ‏همکاران۲۲، دوستی و همکاران۲۳ و فاضلی و همکاران۲۴ به ترتیب ۴۲%، ۴۱% ، ۶/۴۰%  و ۷/۹۸% بود. مقایسه نتایج ‏تحقیق حاضر (۷/۲۱% مقاومت) با تحقیق‌های دیگر نشان داد که مقاومت آنتی بیوتیکی در جدایه‌های سودوموناس آئروژینوزا نسبت ‏به سایر آنتی بیوتیک‌ها کمتر بوده و هنوز کارآیی لازم را جهت درمان بیماران مبتلا به این باکتری دارا می‌باشد. سفتازیدیم ‏آنتی بیوتیک دیگری است که در مطالعه حاضر مورد بررسی قرار گرفت و میزان مقاومت ۶/۲۷% از خود نشان داد. مقایسه این ‏نتیجه با نتایج سایر مطالعات از جمله فاضلی و همکاران (۱۰۰%)۲۴، شاهچراغی و همکاران (۴۲%)۲۲، دوستی و همکاران (۹/۷۸%)۲۳، خسروی و همکاران (۸۱%)۲۵، موحدی و‏‎ ‎همکاران (۷۵%)۲۶،‏ اولیا و‎ ‎همکاران (۴۴/۷۳%)۲۷، نشان می‌دهند نمونه‌های سودوموناس آئروژینوزا در این تحقیق کمترین میزان مقاومت به سفتازیدیم را نسبت به سایر مطالعات دارند. ‏علت عدم مغایرت مطالعه این محققین با مطالعه پیش رو می‌تواند در نوع نمونه، محل انجام آزمون، بازه زمانی و دیسک‌های مورد ‏استفاده باشد. ‏نتایج مقاومت آنتی بیوتیکی در برابر ایمی پنم (۳/۶۳%) در مطالعه میرصالحیان۲۰ و عزیز ژاپنی۲۸ همخوانی ندارد درحالیکه با دیگر مطالعات مانند خسروی و همکاران۲۵، اولیا و همکاران۲۷ و سلامی و همکاران۲۹ همخوانی دارد. علت این عدم همخوانی می‌تواند در نتیجه تفاوت در نمونه­ها و حجم نمونه­گیری باشد. در این تحقیق ۹/۱۳% و ۵/۲۹% از سویه­ها به ترتیب به ایمی­پنم و مروپنم مقاوم بودند. بررسی‌ها نشان می‌دهد، میزان مقاومت ‏نسبت به ایمی­پنم نیز درچند سال اخیر به دلیل انتشار و انتقال ژنهای کدکننده متالوبتالاکتاماز درحال افزایش است. در ‏سال ۲۰۰۴ لوزارو و همکاران نشان دادند که ۱۵% سویه­های سودوموناس آئروژینوزا مقاوم به ایمی­پنم بودند۳۱. این ‏تحقیق نتایج مشابهی را با لوزارو نشان داد، اما نسبت به سایر مطالعات مقاومت کمتری را نشان داد، دلیل این امر می­‏تواند نوع نمونه­های سودوموناس آئروژینوزا باشد که از بیماران غیر بستری مرکز درمانی جدا شده­ند ‏و به همین دلیل مقاومت کمتری را نسبت به ایمی پنم نشان دادند. فرانکو وهمکاران در سال ۲۰۱۰ درتحقیقی که در ‏بیمارستان­ای برزیل انجام گرفت مشاهده کردند که ۱۰۰% بیماران مقاوم به ایمی­نم بودند۳۲. در این تحقیق میزان مقاومت به آمیکاسین ۹/۹% گزارش شد. ماکادو درسال ۲۰۰۰ نشان داد که ۱۵% سویه‌ها مقاوم به آمیکاسین بودند۳۰. شاهچراغی و همکاران در سال ۲۰۰۳ نشان دادند که ۴/۹۳% از سویه­ها مقاوم به آمیکاسین بودند۲۲. زهرا موحدی و همکاران در تحقیقی که درسال۸۹ بر روی کودکان بخش NICU مرکز طبی کودکان انجام دادند با مقاومت ۱۸% در مواجه با آنتی بیوتیک آمیکاسین مواجه شدند۲۶. پروتئین OprL یکی از لیپوپروتئین‌های تشکیل دهنده پمپ ایفلاکس می‌باشد. حضور این ژن علاوه بر اینکه یک عامل حدت در سودوموناس آئروژینوزا می‌باشد، نشانگر مناسبی در جهت تشخیص این گونه باکتریایی به شمار می‌رود. اولین بار Devos و همکاران در سال ۱۹۹۷، آزمون PCR ژن oprL را بر روی ۲۰ گونه متفاوت سودوموناس جدا شده از نمونه‌های بالینی انجام دادند. در این مطالعه فقط گونه‌های سودوموناس آئروژینوزا در PCR این ژن مثبت بودند و بقیه گونه‌های سودوموناس منفی گزارش شدند. حساسیت و ویژگی این روش در مقایسه با روش کشت، به ترتیب ۱۰۰% و ۷۴% گزارش شد۳۳. اصلانی و همکاران درسال ۱۳۸۸، شناسایی ژنهای اختصاصی جنس و گونه oprI و oprL را بر روی نمونه‌های سودوموناس آئروژینوزا جداسازی شده از عفونت‌های تنفسی را انجام دادند. ۱۰۰%نمونه‌ها با روش PCR نسبت به ژن‌های اختصاصی oprI مثبت بودند و تشخیص این گونه با استفاده از این پرایمر دارای حساسیت بالایی گزارش شد۳۴. در مطالعه حاضر از میان نمونه‌های انسانی ۵۱ ایزوله (۱۰۰%) ژن oprI و ۱۷ ایزوله (۳/۳۳%) ژن oprL و از میان نمونه‌های دامی ۲۴ ایزوله (۴۸%) دارای ژن oprL و ۵۱ ایزوله (۱۰۰%) دارای ژن oprI بودند. نجفی و همکاران در سال۱۳۹۲ به بررسی فراوانی ژنهای oprL و algD با طراحی پرایمرهای اختصاصی برای این ژن‌ها پرداختند. از ۷۰ نمونه بالینی مورد بررسی، نتايج مثبت PCR به ترتيب براي ژن‌هاي exoA وoprL در ۶۸ و ۷۰ نمونه به دست آمد كه حساسيت به ترتيب ۲/۹۷% و ۱۰۰% به دست آمد۳۵. در نتایج این مطالعه مشخص شد که فراوانی این دو ژن در بین نمونه‌های انسانی و دامی مشابه است. همچنین نتایج این تحقیق با سایر مطالعات همخوانی دارد. در تانزانیا شم و همکاران در سال ۲۰۰۱ به بررسی ورم پستان‌های تحت بالینی در بین نژادهای مختلف پرداخته و به این نتیجه رسیدند که میزان ابتلا به باکتری سودوموناس آئروژینوزا از درصد کمتری نسبت به استافیلوکوک اورئوس و استرپتوکوک آگالاکتیه برخوردار است و ۲۰ درصد ورم پستان­ها را ناشی از این باکتری گزارش نمودند۳۶. جیانگ و همکاران در بررسی خود سال (۲۰۱۵) بر روی ۲۲۷۵۹ نمونه شیر گاو­های مبتلا به ورم پستان­های تحت بالینی، میزان آلودگی به سودوموناس آئروژینوزا را ۵۵/۶۲ درصد گزارش نمودند (۳۷). در پژوهشی بر روی باکتریهای ایجادکننده ورم پستان دوره خشکی در تبریز به این نتیجه رسیدند که ۳۲/۱۳ درصد نمونه­ها آلوده به سودوموناس آئروژینوزا می­باشند. کیرک و همکاران برنامه مدونی برای کنترل ورم پستان‌های ناشی از سودوموناس آئروژینوزا در گله­های شیری ارائه می­کنند. او در این برنامه به عوامل ایجاد کننده و راههای کنترل و مهار این عوامل در جهت کاهش ورم پستان ناشی از سودوموناس آئروژینوزا می­پردازد. وی در این برنامه به انجام مرتب و دوره ای کشت نمونه‌های شیر دامهای دارای علائم، کنترل و آزمایشات میکروبی آب دامداری، اجرای برنامه صحیح بهداشتی اشاره می‌نماید۳۸. زادوکس و همکاران در سال (۲۰۱۱)، استفاده از محلول کلرهگزیدین را در ضدعفونی سرپستان‌ها در کاهش میزان ابتلا موثر می‌دانند۳۹. سودوموناس آئروژینوزا از جمله باكتري‌هاي مقاوم است كه به دليل كاهش نفوذپذيري دارو و توليد آنزيم‌هاي مختلف، داراي مقاومت بالايي نسبت به آنتي بيوتيك‌ها می‌باشد. تیله و همکاران در سال (۲۰۰۳)، بررسی بر روی میزان حساسیت آنتی بیوتیکی عوامل ایجاد کننده ورم پستان در گله گاوهای شیری را انجام داده و میزان مقاومت باکتری سودوموناس آئروژینوزا جداشده از ورم پستان گاوهای مبتلا را که دارای سنین مختلف بودند گزارش نمودند. در نتایج تیله میزان مقاومت باکتری سودوموناس آئروژینوزا به آنتی بیوتیک‌های آمپی سیلین، آموکسی سیلین، تتراسایکلین، انروفلوکساسین، تری­متوپریم/سولفانامید، سفوپرازون و استرپتومایسین بین سالهای ۲۰۰۳-۱۹۹۹ به ترتیب برابر با ۹۴ درصد، ۹۳ درصد، ۱۰۰ درصد، ۱۰۰ درصد، ۹۶ درصد اعلام شد۴۰. درتحقیق سال ۹۲ ‏دوستی و همکاران ۱/۵۵% از بیماران مقاوم به ایمی­پنم بودند۲۳.‏ خوشبختانه در مطالعه ما مشخص گردید که هیچ یک از نمونه­های دامی نسبت به ایمی­پنم مقاومت نداشته ولی میزان مقاومت در برابر آنتی­بیوتیکهای تتراسایکلین و آمپی­سیلین با توجه به مصرف زیاد این نوع آنتی­بیوتیکها رو به افزایش بوده که می­بایست روند انتخاب شیوه درمان در بین مزارع پرورش گاو تغییر یابد. اگزوتوکسین A سم اصلی تولید شده توسط باکتری سودوموناس آئروژینوزا بوده و از عوامل مرگ و میر می­باشد. این سم به صورت کروموزمومی کد شده و از ژن آن فقط یک نسخه وجود دارد که در ۹۰% سویه­ها شناسایی شده است. این سم با غیر فعال ساختن فاکتور ۲ طویل سازی پروتئین موجب توقف سنتز و در نهایت مرگ سلول می‌شود. اگزوتوکسین A دارای ۳ ناحیه می‌باشد: ناحیه ۱ به رسپتورهای سلول میزبان متصل شده و اندوسیتوز را آغاز می‌کند، با اسیدی شدن اندوزوم، ناحیه ۲ حرکت توکسین به سمت سیتوپلاسم را موجب شده و ناحیه ۳ انتقال ADP ریبوز به EF2 را کاتالیز می‌کند۱۰.

 

نتیجه‌گیری

با توجه به اهمیت شناسایی سریع باکتری سودوموناس آئروژینوزا و با توجه به مشکلات موجود در روشهای بیوشیمیایی، روشهای مولکولی مانند PCR روشی حساس و سریع در شناسایی این باکتری می‌باشد. به علاوه شناسایی همزمان چند فاکتور ویرولانس و با روش Multiplex PCR اختصاصیت بالایی به این کار می‌بخشد. ژنهای oprL و ETA دارای شیوع بالایی در جدایه‌های سودوموناس آئروژینوزا می‌باشند و نشانگر مناسبی جهت تشخیص این باکتری می‌باشند. اگزوتوکسین A بعلاوه اینکه از عوامل اصلی پاتوژنز باکتری سودوموناس آئروژینوزا است، شیوع بالایی نیز در بین ایزوله‌ها دارد. بنابراین لزوم توجه به سویه‌های جدا شده از بالین و دام که حاوی این ژن هستند وجود دارد تا از اثرات این توکسین بر بافت‌های دامی و انسانی جلوگیری شود. مقاومت‌های آنتی بیوتیکی در سویه‌های دامی و انسانی شیوع بالایی دارند و لزوم توجه به مصرف مناسب و به اندازه آنتی بیوتیک‌ها احساس می‌شود.

 

سپاسگزاری

این مقاله مستخرج از پایان نامه با کد ۶۷۸  در دانشکده دامپزشکی تهران بوده و از کلیه عزیزانی که در انجام این فعالیت علمی راهنمایی مفید و ارزنده داشتند قدردانی و تشکر می­گردد.

 

References

 

  1. Stover C, Pham X, Erwin A, Mizoguchi S, Warrener P, Hickey M, et al. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature. 2000;406(6799):959-64.
  2. Choi K-H, Kumar A, Schweizer HP. A 10-min method for preparation of highly electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer between chromosomes and plasmid transformation. Journal of microbiological methods. 2006;64(3):391-7.
  3. Smith EE, Buckley DG, Wu Z, Saenphimmachak C, Hoffman LR, D’Argenio DA, et al. Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proceedings of the National Academy of Sciences. 2006;103(22):8487-92.
  4. Perron K, Caille O, Rossier C, van Delden C, Dumas J-L, Köhler T. CzcR-CzcS, a two-component system involved in heavy metal and carbapenem resistance in Pseudomonas aeruginosa. Journal of Biological Chemistry. 2004;279(10):8761-8.
  5. Smith RS, Iglewski BH. Pseudomonas aeruginosa quorum sensing as a potential antimicrobial target. Journal of Clinical Investigation. 2003;112(10):1460.
  6. Jae LT, Raaben M, Riemersma M, van Beusekom E, Blomen VA, Velds A, et al. Deciphering the glycosylome of dystroglycanopathies using haploid screens for lassa virus entry. Science. 2013;340(6131):479-83.
  7. Carmeli Y, Troillet N, Karchmer AW, Samore MH. Health and economic outcomes of antibiotic resistance in Pseudomonas aeruginosa. Archives of Internal Medicine. 1999;159(10):1127-32.
  8. Arun IS. Studies on Immunogenicity and Protective Efficacy of Different Recombinant Proteins of Pseudomonas aeruginosa 2015.
  9. Köhler T, Buckling A, Van Delden C. Cooperation and virulence of clinical Pseudomonas aeruginosa populations. Proceedings of the National Academy of Sciences. 2009;106(15):6339-44.
  10. Aghaei SS, Javadi A, Sharifi Y, Morovvati A. Detection of Exotoxin A, Y, T, U, S genes of Pseudomonas aeruginosa Isolates Resistant to Third-Generation Cephalosporins in Clinical Samples of Hospitalized Patients in Hospitals of Qom City, Iran. Qom University of Medical Sciences Journal. 2016;10(1):48-55.
  11. Sana TG, Baumann C, Merdes A, Soscia C, Rattei T, Hachani A, et al. Internalization of Pseudomonas aeruginosa strain PAO1 into epithelial cells is promoted by interaction of a T6SS effector with the microtubule network. MBio. 2015;6(3):e00712-15.
  12. Bannerman DD, Chockalingam A, Paape MJ, Hope JC. The bovine innate immune response during experimentally-induced Pseudomonas aeruginosa mastitis. Veterinary immunology and immunopathology. 2005;107(3):201-15.
  13. Rella M, Haas D. Resistance of Pseudomonas aeruginosa PAO to nalidixic acid and low levels of beta-lactam antibiotics: mapping of chromosomal genes. Antimicrobial Agents and Chemotherapy. 1982;22(2):242-9.
  14. Miller WL, Matewish MJ, McNally DJ, Ishiyama N, Anderson EM, Brewer D, et al. Flagellin glycosylation in Pseudomonas aeruginosa PAK requires the O-antigen biosynthesis enzyme WbpO. Journal of Biological Chemistry. 2008;283(6):3507-18.
  15. Khan AA, Cerniglia CE. Detection of Pseudomonas aeruginosa from clinical and environmental samples by amplification of the exotoxin A gene using PCR. Applied and environmental microbiology. 1994;60(10):3739-45.
  16. Salman M, Ali A, Haque A. A novel multiplex PCR for detection of Pseudomonas aeruginosa: A major cause of wound infections. Pakistan journal of medical sciences. 2013;29(4):957.
  17. Gawish AA, Mohamed NA, El-Shennawy GA, Mohamed HA. An investigation of type 3 secretion toxins encoding-genes of Pseudomonas aeruginosa isolates in a University Hospital in Egypt. Journal of Microbiology and Infectious Diseases. 2013;3(03).
  18. Azargoon R, Doustdar F, Khanbabaei G, Ghazi M, Mehrnejad F, Goudarzi H. Type III secretion system characterization of Pseudomonas aeruginosa isolates associated with cystic fibrosis. Research in Medicine. 2013;37(3):1890-193.
  19. Mirsalehian A, Bahador A, Bigverdi R, Goli H. Prevalence of MBL-producing Pseudomonas aeruginosa isolated from burn patients. Tehran University of Medical Sciences. 2011;68(10).
  20. Yazdi HR, Nejad GB, Peerayeh SN, Mostafaei M. Prevalence and detection of metallo-β-lactamase (MBL)-producingPseudomonas aeruginosa strains from clinical isolates in Iran. Annals of microbiology. 2007;57(2):293.
  21. Shahcheraghi F, Nikbin VS, Feizabadi MM. Identification and genetic characterization of metallo-beta-lactamase-producing strains of Pseudomonas aeruginosa in Tehran, Iran. New Microbiologica. 2010;33(3):243-8.
  22. Doosti M, Ramazani A, Garshasbi M. Identification and characterization of metallo-β-lactamases producing Pseudomonas aeruginosa clinical isolates in University Hospital from Zanjan Province, Iran. Iranian biomedical journal. 2013;17(3):129.
  23. Fazeli H, Moslehi Z, Irajian G, Salehi M. Determination of Drug resistance patterns and detection of bla-VIM gene in Pseudomonas aeruginosastrains Isolated from burned patients in the Emam Mosa Kazem hospital, Esfahan, Iran (2008-9). Iranian Journal of Medical Microbiology. 2010;3(4)1-8.
  24. Khosravi AD, Mihani F. Detection of metallo-β-lactamase–producing Pseudomonas aeruginosa strains isolated from burn patients in Ahwaz, Iran. Diagnostic microbiology and infectious disease. 2008;60(1):125-8.
  25. Movahedi Z, Pourakbari B, Mahmoudi S, Sabouni F, ASHTIAnI MH, Sadeghi RH, et al. Pseudomonas aeruginosa infection among cystic fibrosis and ICU patients in the referral children medical hospital in Tehran, Iran. Journal of preventive medicine and hygiene. 2013;54(1):24.
  26. Owlia P, Saderi H, Karimi Z, Rad A, Bagher SM, Bahar MA. Phenotypic detection of Metallo-beta-Lactamase producing Pseudomonas aeruginosa strains isolated from burned patients. Iranian Journal of Pathology. 2008;3(1):20-5.
  27. Japoni A, Alborzi A, Kalani M, Nasiri J, Hayati M, Farshad S. Susceptibility patterns and cross-resistance of antibiotics against Pseudomonas aeruginosa isolated from burn patients in the South of Iran. Burns. 2006;32(3):343-7.
  28. Salami H. owlia P, Yakhchali B, Rastegar lari A. Drug susceptibility and molecular epidemiology of pseudomonas aeruginosa isolated in a burn unit. J infect Dis. 2009;5(4):308-13.
  29. Makedou K, Tsiakiri E, Bisiklis A, Chatzidimitriou M, Halvantzis A, Ntoutsou K, et al. Changes in antibiotic resistance of the most common Gram-negative bacteria isolated in intensive care units. Journal of Hospital Infection. 2005;60(3):245-8.
  30. Luzzaro F, Endimiani A, Docquier J-D, Mugnaioli C, Bonsignori M, Amicosante G, et al. Prevalence and characterization of metallo-β-lactamases in clinical isolates of pseudomonas aeruginosa. Diagnostic microbiology and infectious disease. 2004;48(2):131-5.
  31. Franco MRG, Caiaffa-Filho HH, Burattini MN, Rossi F. Metallo-beta-lactamases among imipenem-resistant Pseudomonas aeruginosa in a Brazilian university hospital. Clinics. 2010;65(9):825-9.
  32. Devos D, Garmendia J, Lorenzo Vd, Valencia A. Deciphering the action of aromatic effectors on the prokaryotic enhancer‐binding protein XylR: a structural model of its N‐terminal domain. Environmental microbiology. 2002;4(1):29-41.
  33. Aslani M, Hashemipour M, NikBin V, Shahcheraghi F, Eydi A, Sharafi Z. PCR identification of Pseudomonas aeruginosa based on two outermembrane lipoprotein oprI, oprL, and exotoxin A gene. J Med Sci Lorestan. 2009;11(2):21-6.
  34. Rafatbakhsh-Iran S, Salehzadeh A, Yousefimashouf R, Najafimosleh M, Karimitabar Z, Khedri M. Bacteria of Phlebotominae Sand Flies Collected in Western Iran. Iranian Journal of Health, Safety and Environment. 2015;2(3):313-9.
  35. Shem M, Malole J, Machangu R, Kurwijila L, Fujihara T. Incidence and causes of sub-clinical mastitis in dairy cows on smallholder and large scale farms in tropical areas of Tanzania. Asian Australasian Journal of Animal Sciences. 2001;14(3):372-7.
  36. Zhong H, Jiang Y, Zeng G, Liu Z, Liu L, Liu Y, et al. Effect of low-concentration rhamnolipid on adsorption of Pseudomonas aeruginosa ATCC 9027 on hydrophilic and hydrophobic surfaces. Journal of hazardous materials. 2015;285:383-8.
  37. Kirk J, Mellenberger R. Pseudomonas-infected dairy cows. Extension bulletin E-Cooperative Extension Service. 1987.
  38. Zadoks RN, Middleton JR, McDougall S, Katholm J, Schukken YH. Molecular epidemiology of mastitis pathogens of dairy cattle and comparative relevance to humans. Journal of mammary gland biology and neoplasia. 2011;16(4):357-72.
  39. Teale C, Martin P, Watkins G. VLA antimicrobial sensitivity report. UK: Crown. 2002.
  40. Doosti A, Pourabbas M, Arshi A, Chehelgerdi M, Kabiri H. TEM and SHV genes in Klebsiella pneumoniae isolated from cockroaches and their antimicrobial resistance pattern. Osong public health and research perspectives. 2015;6(1):3-8.

 

 

سودوموناس آئروژینوزا ، Multiplex-PCR‏ ، مقاومت آنتی­بیوتیکی، آلژینات، اگزوتوکسین

 

Leave a Comment